a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
Do you need a similar assignment done for you from scratch? We have qualified writers to help you. We assure you an A+ quality paper that is free from plagiarism. Order now for an Amazing Discount!Use Discount Code “Newclient” for a 15% Discount!NB: We do not resell papers. Upon ordering, we do an original paper exclusively for you.
What Students Are Saying About Us
.......... Customer ID: 12*** | Rating: ⭐⭐⭐⭐⭐"Honestly, I was afraid to send my paper to you, but splendidwritings.com proved they are a trustworthy service. My essay was done in less than a day, and I received a brilliant piece. I didn’t even believe it was my essay at first 🙂 Great job, thank you!"
.......... Customer ID: 14***| Rating: ⭐⭐⭐⭐⭐
"The company has some nice prices and good content. I ordered a term paper here and got a very good one. I'll keep ordering from this website."
